A global alignment is one that compares the two sequences over their entire lengths, and is appropriate for comparing sequences that are expected to share similarity over the whole length. The alignment maximises regions of similarity and minimises gaps using the scoring matrices and gap parameters provided to the program. The wEMBOSS program needle is an implementation of the Needleman-Wunsch [3] algorithm for global alignment; the computation is rigorous and needle can be time consuming to run if the sequences are long.

Exercise: needle

Program: needle

(Needleman-Wunsch global alignment).

Input sequence: xlrhodop

Second sequence: xl23808

Gap opening penalty [10.0]:

Gap extension penalty [0.5]:

Result:

########################################

# Program: needle

# Rundate: Mon 21 Apr 2008 14:04:19

# Commandline: needle

#    -asequence xlrhodop

#    -sbegin1 1

#    -send1 1684

#    -bsequence xl23808

#    -gapopen 10.0

#    -gapextend 0.5

#    -brief

#    -aformat srspair

#    -auto

# Align_format: srspair

# Report_file: .needle.08.04.21:14.04.19/l07770.needle

########################################

#=======================================

#

# Aligned_sequences: 2

# 1: L07770

# 2: XL23808

# Matrix: EDNAFULL

# Gap_penalty: 10.0

# Extend_penalty: 0.5

#

# Length: 4734

# Identity:    1683/4734 (35.6%)

# Similarity:  1683/4734 (35.6%)

# Gaps:        3050/4734 (64.4%)

# Score: 7471.0

#

#

#=======================================

XL23808         1101 aatcctttgttcgtgacgctgggggttgcaagcttactccaggtgggact   1150

L07770             1 ------------------------------ggtagaacagcttcagttgg     20

                                                   .|||||||||||||||||||

XL23808         1151 ttaaaaggacgaggggacagtgggtcatactgtagaacagcttcagttgg   1200

L07770            21 gatcacaggcttctagggatcctttgggcaaaaaagaaacacagaaggca     70

                     ||||||||||||||||||||||||||||||||||||||||||||||||||

XL23808         1201 gatcacaggcttctagggatcctttgggcaaaaaagaaacacagaaggca   1250

We've only shown part of the output, as it is very long. You should look at the whole output and note that there are five aligned regions that represent the five exons as predicted from the dotplot.