User login

Biological databases an introduction

Extracting information from databases

  1. Please find the name of the gene this sequence belongs to (describe how you did)
  2. Are other databases cross-referenced to the sequence information you found? Name some of them!
  3. Any known splice variant?
  4. Find out to which protein family this protein belongs to.
  5. Find sequences of this protein in 5 other species and do a multiple alignment.
  6. Use these sequences to answer to the question: which is the closest relative (with known genome) to the human.

Present the following graphs on your report:

  • Figure A: Splice variants
  • Figure B: known domains/motifs
  • Figure C: A multiple alignment of this protein with at least 5 homologues.

Save your results to be compared to the results after doing the eBioKit in-build tutorials.

Here is the sequence:

ATGGAGAGGAGACGCATCACCTCCGCTGCTCGCCGCTCCTACGTCTCCTCAGGGGAGATGATGGTGGGGGGC
CTGGCTCCTGGCCGCCGTCTGGGTCCTGGCACCCGCCTCTCCCTGGCTCGAATGCCCCCTCCACTCCCGACC
CGGGTGGATTTCTCCCTGGCTGGGGCACTCAATGCTGGCTTCAAGGAGACCCGGGCCAGTGAGCGGGCAGAG
ATGATGGAGCTCAATGACCGCTTTGCCAGCTACATCGAGAAGGTTCGCTTCCTGGAACAGCAAAACAAGGCG
CTGGCTGCTGAGCTGAACCAGCTGCGGGCCAAGGAGCCCACCAAGCTGGCAGACGTCTACCAGGCTGAGCTG
CGAGAGCTGCGGCTGCGGCTCGATCAACTCACCGCCAACAGCGCCCGGCTGGAGGTTGAGAGGGACAATCTG
GCACAGGACCTGGCCACTGTGAGGCAGAA